Bio-Path Holdings ( (BPTH) ) has released its Q3 earnings. Here is a breakdown of the information Bio-Path Holdings presented ...

Expands DNAbilize® Technology Beyond Oncology into Obesity Conference Call to be Held Today at 8:30 A.M. ET HOUSTON, Nov. 15, 2024 (GLOBE NEWSWIRE) -- Bio-Path Holdings, Inc., (NASDAQ:BPTH), a biotech ...

Expands DNAbilize® Technology Beyond Oncology into Obesity Conference Call to be Held Today at 8:30 A.M. ET HOUSTON, Nov. 15, 2024 (GLOBE NEWSWIRE) -- , (NASDAQ:BPTH), a biotechnology company ...

Researchers have used microcellular "drones" to deliver antisense oligonucleotide therapeutics to lung cancer cells.

Lung cancer, specifically Non-Small Cell Lung Cancer (NSCLC)-the most common subtype of cancer contracted by patients who do not smoke, is a leading ...

In a study led by researchers at the NUS Yong Loo Lin School of Medicine, extracellular vesicles loaded with customizable ...

The sequences of the siRNAs are following: sense sequence of #1 siRNA, GGAGUGAUCCUUAUCGUGATT; antisense sequence of #1 siRNA, UCACGAUAAGGAUCACUCCAG, sense sequence of #2 siRNA, CUUGCUUAAUAUACAGAAATT; ...

TMDU researchers demonstrate proof of concept of antisense nucleic acid therapy to prevent the spread of α-synuclein pathologies in synucleinopathies. A new preclinical model offers a unique ...

Department of Medicinal Chemistry, College of Pharmacy, University of Utah, 2000 East 30 South Skaggs 306, Salt Lake City, Utah 84112, United States ...